help with creating random strings in an array

Hi all, (first time poster...long time reader)

I am having trouble getting the random concept down. In my assignment, i have to create a random strings of user determined length and number. I have no problem with the iteration, but when it comes to creating the strings, thats when i don't have a clue. From what i have read from the book and websites i think that it goes something like this:
java.util.* public someclass{ String[] alphabet ={a,b,c,d,e,f,g,h,i}; Random r = new Random(); public void createRandom(){ letter= r.nextInt(alhabet[r]);//creates a random letter from the alphabet array, i think??? } public String getRandom(){//returns the random letter return this.letter; }

Is that correct???

I'll give you a piece of code:
letter = alphabet[r.nextInt(alphabet.length)]

nextInt(x) returns an integer >= 0 and <x

This gives you one random letter.

You can assemble a String from letters using StringBuffer, you can easily make StringBuffers into Strings with a String constructor, and you can put references to your Strings in a String[] array.
[ November 10, 2004: Message edited by: Mike Gershman ]

I am still having a lot of trouble with Random... when i enter the code snippet that you gave me among with other code. I keep getting null exceptions, or the first letter of my array. I am completely at a loss.
Any help would be appreciated.

Thanks

Corbin

Since this is for an assignment, we wouldn't want to do your work for you and give you the code. Post your code and we'll try to point you in the right direction.

There are days when any of us would be happy to make one or two lines of code run! What's the simplest thing you can possibly try? Maybe:
Random r = new Random(); System.out.println(r.nextInt()); System.out.println(r.nextInt()); System.out.println(r.nextInt());
just to get a feel for the ints you're going to get.

If you want to use one of those ints to pick a random letter out of the alphabet you'll probably use the int as an index into your array of letters. That's a fine idea, but look at those ints. Some are going to be too big for your array. Read up on Random javadoc to see how to get numbers in the range you want ... 0 through number of letters minus 1.

So try a few more lines:
String result = ""; int index = ... get a random number in the right range ... char letter = ... get a letter from your alphabet array ... result = ... add that character to your result ... System.out.println(result);
If you get that going, put it in a for loop to get the right number of letters.

Any of that help?

Okay, i got a little further in my program, now the problem is that i need my for loops to print out strings like:

ATTAGACATTAC
ATTAGAAATCCC
CCCATACACACA
...etc.

What I am getting is.

ATTAGACATTACATTAGAAATCCCCCCATACACACA

what am i doing wrong?
public String getrandomSequence(int number, int length) { Random generator = new Random(); String DNA = ""; for(int i = 0; i <= number; i++){// number of sequences to be made for(int j = 0; j < length; j++){//length of sequences to be made; if(length >= seqArray.length) seqArray = doubleArray(); int d = generator.nextInt(4); DNA = DNA + gene[d]; } } return DNA; }

It looks like you're just putting everything into one big String (DNA). Do you want to put them into a String[] instead? After your inner loop, put DNA into an array., and then reset DNA to """.

Your method should probably return a String[] instead of a String, too.

>> ATTAGACATTACATTAGAAATCCCCCCATACACACA
>> what am i doing wrong?

What Joel said.

public String getrandomSequence(int number, int length) { Random generator = new Random(); String DNA = ""; for(int i = 0; i <= number; i++){// number of sequences to be made for(int j = 0; j < length; j++){//length of sequences to be made; if(length >= seqArray.length) seqArray = doubleArray(); int d = generator.nextInt(4); DNA = DNA + gene[d]; } } return DNA; }

There's really no need to test for length >= seqArray.length inside the loop. In fact, I don't see a need for the seqArray at all in the code you posted. Also, I would take Mike's suggestion and use a StringBuffer. And you should not be using the "magic number" 4. The argument you pass to nextInt() should be the length of the gene array. I would also break out the inner loop into its own method:

public void printSequences(int number, int length) { for (int i = 0; i < number; i++) { System.out.println(getRandomSequence(length)); } } public String getRandomSequence(int length) { ... StringBuffer dna = new StringBuffer(length); for ... dna.append(gene[generator.nextInt(gene.length)]); return dna.toString(); }

Here is an good example
code:

class RandString{
private static String ssource =
"ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz";
private static char[] src = ssource.toCharArray();
public static class
RandCharGenerator implements CharGenerator {
public char next() {
return src[r.nextInt(src.length)];
}
}
public static class
RandStringGenerator implements Generator {
private int len;
private RandCharGenerator cg = new RandCharGenerator();
public RandStringGenerator(int length) {
len = length;
}
public Object next() {
char[] buf = new char[len];
for(int i = 0; i < len; i++)
buf[i] = cg.next();
return new String(buf);
}
}
}