• Post Reply Bookmark Topic Watch Topic
  • New Topic
programming forums Java Mobile Certification Databases Caching Books Engineering Micro Controllers OS Languages Paradigms IDEs Build Tools Frameworks Application Servers Open Source This Site Careers Other Pie Elite all forums
this forum made possible by our volunteer staff, including ...
Marshals:
  • Campbell Ritchie
  • Devaka Cooray
  • Tim Cooke
  • Jeanne Boyarsky
  • Ron McLeod
Sheriffs:
Saloon Keepers:
  • Piet Souris
Bartenders:

help with creating random strings in an array

 
Greenhorn
Posts: 22
  • Mark post as helpful
  • send pies
    Number of slices to send:
    Optional 'thank-you' note:
  • Quote
  • Report post to moderator
Hi all, (first time poster...long time reader)

I am having trouble getting the random concept down. In my assignment, i have to create a random strings of user determined length and number. I have no problem with the iteration, but when it comes to creating the strings, thats when i don't have a clue. From what i have read from the book and websites i think that it goes something like this:


Is that correct???
 
Ranch Hand
Posts: 1272
  • Mark post as helpful
  • send pies
    Number of slices to send:
    Optional 'thank-you' note:
  • Quote
  • Report post to moderator
I'll give you a piece of code:
letter = alphabet[r.nextInt(alphabet.length)]

nextInt(x) returns an integer >= 0 and <x

This gives you one random letter.

You can assemble a String from letters using StringBuffer, you can easily make StringBuffers into Strings with a String constructor, and you can put references to your Strings in a String[] array.
[ November 10, 2004: Message edited by: Mike Gershman ]
 
Corbin Blake
Greenhorn
Posts: 22
  • Mark post as helpful
  • send pies
    Number of slices to send:
    Optional 'thank-you' note:
  • Quote
  • Report post to moderator
I am still having a lot of trouble with Random... when i enter the code snippet that you gave me among with other code. I keep getting null exceptions, or the first letter of my array. I am completely at a loss.
Any help would be appreciated.

Thanks

Corbin
 
Sheriff
Posts: 17783
306
Mac Android IntelliJ IDE Eclipse IDE Spring Debian Java Ubuntu Linux
  • Mark post as helpful
  • send pies
    Number of slices to send:
    Optional 'thank-you' note:
  • Quote
  • Report post to moderator
Since this is for an assignment, we wouldn't want to do your work for you and give you the code. Post your code and we'll try to point you in the right direction.
 
(instanceof Sidekick)
Posts: 8791
  • Mark post as helpful
  • send pies
    Number of slices to send:
    Optional 'thank-you' note:
  • Quote
  • Report post to moderator
There are days when any of us would be happy to make one or two lines of code run! What's the simplest thing you can possibly try? Maybe:

just to get a feel for the ints you're going to get.

If you want to use one of those ints to pick a random letter out of the alphabet you'll probably use the int as an index into your array of letters. That's a fine idea, but look at those ints. Some are going to be too big for your array. Read up on Random javadoc to see how to get numbers in the range you want ... 0 through number of letters minus 1.

So try a few more lines:

If you get that going, put it in a for loop to get the right number of letters.

Any of that help?
 
Corbin Blake
Greenhorn
Posts: 22
  • Mark post as helpful
  • send pies
    Number of slices to send:
    Optional 'thank-you' note:
  • Quote
  • Report post to moderator
Okay, i got a little further in my program, now the problem is that i need my for loops to print out strings like:

ATTAGACATTAC
ATTAGAAATCCC
CCCATACACACA
...etc.

What I am getting is.

ATTAGACATTACATTAGAAATCCCCCCATACACACA

what am i doing wrong?
 
Bartender
Posts: 1844
Eclipse IDE Ruby Java
  • Mark post as helpful
  • send pies
    Number of slices to send:
    Optional 'thank-you' note:
  • Quote
  • Report post to moderator
It looks like you're just putting everything into one big String (DNA). Do you want to put them into a String[] instead? After your inner loop, put DNA into an array., and then reset DNA to """.

Your method should probably return a String[] instead of a String, too.
 
Junilu Lacar
Sheriff
Posts: 17783
306
Mac Android IntelliJ IDE Eclipse IDE Spring Debian Java Ubuntu Linux
  • Mark post as helpful
  • send pies
    Number of slices to send:
    Optional 'thank-you' note:
  • Quote
  • Report post to moderator
>> ATTAGACATTACATTAGAAATCCCCCCATACACACA
>> what am i doing wrong?

What Joel said.



There's really no need to test for length >= seqArray.length inside the loop. In fact, I don't see a need for the seqArray at all in the code you posted. Also, I would take Mike's suggestion and use a StringBuffer. And you should not be using the "magic number" 4. The argument you pass to nextInt() should be the length of the gene array. I would also break out the inner loop into its own method:

 
Greenhorn
Posts: 11
  • Mark post as helpful
  • send pies
    Number of slices to send:
    Optional 'thank-you' note:
  • Quote
  • Report post to moderator
Here is an good example
code:

class RandString{
private static String ssource =
"ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz";
private static char[] src = ssource.toCharArray();
public static class
RandCharGenerator implements CharGenerator {
public char next() {
return src[r.nextInt(src.length)];
}
}
public static class
RandStringGenerator implements Generator {
private int len;
private RandCharGenerator cg = new RandCharGenerator();
public RandStringGenerator(int length) {
len = length;
}
public Object next() {
char[] buf = new char[len];
for(int i = 0; i < len; i++)
buf[i] = cg.next();
return new String(buf);
}
}
}
 
With a little knowledge, a cast iron skillet is non-stick and lasts a lifetime.
reply
    Bookmark Topic Watch Topic
  • New Topic